Skip to main content

Table 3 Primer sequences of 20 genes examined in the study

From: Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR

No. Symbol Ct Left Right
1 AMY2A 25-31 GGGTTCGTATTTATGTGGATGC GGGTTCGTATTTATGTGGATGC
2 BEX1 21-31 GCCTAGAGGAAATCGTAGGCGGTTC CTCTCATCCTTGCCTGTGGTTCTCC
3 CDH1 22-33 TGGGCAGCTATCCAGTGACTTGTTC CTGTCTTTGGCTGCAGCACTTTAGG
4 CSTA 25-35 CACTTTGGTTCCAGCATCCTGTC ACAATCTCCTGGATTTCTGGAGTG
5 DUSP4 20-29 CTGCTTCTCAGTGGCAACAAAC CCGTAGCATGCAGATGTCAAGG
6 FOSL1 18-22 TAAGGCGCGAGCGGAACAAG TCGCTGCAGCCCAGATTTCTC
7 FOXG1 23-36 GCGCCAGCAGCACTTTGAGTTAC TGGTTGTTGCCCAGCGAGTTC
8 GAPDH(GAPD) 21-22 AGTAGAGGCAGGGATGATGTTC CTTTGGTATCGTGGAAGGACTC
9 HMGA1 17-20 GCGAAGTGCCAACACCTAAGAGACC CCTTGGTTTCCTTCCTGGAGTTGTG
10 IGSF3 24-35 GACCTCATTGCGCATTGTCTAC CATGTCCTAGAATGCGCCTAG
11 INADL 23-31 AGAATGGACTTGGACTCAGCCTTGC CATCTCCAATACGCATTCGTCCATC
12 ISL1 24-33 GTACGGGATCAAATGCGCCAAG AGGCCACACAGCGGAAACACTC
13 MALL(BENE) 21-33 CATTACATCCGTGGATTCTCC GTGCTTAAGAGAATGTGAGGG
14 PLAU 21-31 CGCTGCTCCCACATTGGCTAAG TGTGCATGGGTGAAGGGAGAGC
15 RAB25 21-33 TGATCGGCGAATCAGGTGTGG CAACATCACAGTGCGGGTGGAG
16 S100A2 22-27 GCAGCCTGGATGAGAACAGTGACC CAGCCCTGGAAGAAGTCATTGCAC
17 S100P 18-32 GTCTGAATCTAGCACCATGACG GGAAGCCTGGTAGCTCCTTC
18 SLCO4A1 22-32 TCCATCTGGCTCCTGCTGAAGAAC GCTTCTGAGGCACTCAGGCTGAAC
19 STMN1 21-25 AAAGAACTGGAGAAGCGTGCCTCAG CTGAATTTCCTCCAGGGAAAGATCC
20 TGM2 21-36 CTGGTCACTAACCAACAAGGTTG GAGCAGGAGATAAAGTCAAAGCTG
  1. Ct: cycle threshold.