Skip to main content

Advertisement

Table 1 Primers involved in RT-PCR reaction.

From: Determination of the differentiation capacities of murines' primary mononucleated cells and MC3T3-E1 cells

Genes Primers Sequence Expected Product Size (bp)
Gapdh Forward 5' CACTCCAATCGTCCCTACA 3'  
  Reverse 5' AAGGTGGAAGAGTGGGAG 3' 717
Opn Forward 5' CACTCCAATCGTCCCTACA 3'  
  Reverse 5' GCTGCCCTTTCCGTTGTT 3' 234
CatK Forward 5'GGCAGGGTCCCAGACTCCAT3'  
  Reverse 5'GTGTTGGTGGTGGGCTAC3' 350
Sca-1 Forward 5'GGCAGGGTCCCAGACTCCAT3'  
  Reverse 5'GTGTTGGTGGTGGGCTAC3' 167
  1. Gapdh; glyceraldehyde-3-phosphate dehydrogenase as housekeeping gene, Opn; Osteopontin as osteoblast marker, CatK; Catepsin K as osteoclast marker, Sca-1; Stem cell antigen-1 as murine hematopoietic stem cell marker.