Skip to main content

Table 3 Methylation specific primer (MSP) pairs.

From: Loss of glutathione peroxidase 3 expression is correlated with epigenetic mechanisms in endometrial adenocarcinoma

Primer pairs Forward primer Reverse primer Fragment size
(bp)
Methylated GTTGTTATTGGTTAGGAAGTTTTCG GCGTCTTAAAATAACCACCGTC 114
Unmethylated TTGTTATTGGTTAGGAAGTTTTTGG AACACATCTTAAAATAACCACCATC 116
Actb GGAAATCGTGCGTGACATTA AGGAAGGAAGGCTGGAAGAG 183
  1. Methylation specific primer (MSP) pairs for Gpx3 used in the methylation specific PCR. The gene Actb was used as control.