Skip to main content

Table 5 Primers used for the construction of the Gpx 3 specific probe.

From: Loss of glutathione peroxidase 3 expression is correlated with epigenetic mechanisms in endometrial adenocarcinoma

Primer   Sequence Product size
(bp)
Exon 1 F TTCTCCCCAAAACCACTGAG  
  R CCCTTCTCTCCCTCCTAAGC 583
Exon 2 F GTGGTCCCATGATGCTCTCT  
  R GGGTTCAAGATTTGGGTGTG 592
Exon 3 F CTGTAGCAGCCATCCAACTG  
  R ACCTTGTTCTGTCCGTCACC 588
Exon 4 F GAAGAGACAGGCTGGGTGAT  
  R CCCAAAGAGACCACCATCTC 589
Exon 5 F TCCATGTCAGCCACTCACTC  
  R GAAGTTGTAGGCCCTGAGA 594
Exon 6 F TAAGACTGATGCCCCCTCAC  
  R AGGTTTGAGCAGGACCATTG 587