Skip to main content

Advertisement

Table 2 Sequences and PCR conditions for primers

From: Differences in the epigenetic regulation of MT-3 gene expression between parental and Cd+2 or As+3 transformed human urothelial cells

Promoter regions Upper primer Lower primer Product size (bp) Annealing temperature °C
MRE A & B AAAGAGCGGGCGCGGTGC GACGCGCGGCTTGGCTAGTGG 111 75
MRE C GGCCCCGGCAGTGCACA GCGCACGCACTGCATCTGTCG 55 75
MRE E, F, G ATGGTACGTGCGCGCTTCC CATCCGCGTGCACGACCCACT 124 70
Region 1 GAACAGATCTGGCGTCCTG GCGCACGTACCATCTCCGA 111 63
Region 2 GTCGGGCTCATCGTGA ATTCTCCAGGACGCCAGAT 77 61