Skip to main content

Advertisement

Table 3 Primers used to detect exon-deleted splice variants in paralemmin-1

From: Paralemmin-1 is over-expressed in estrogen-receptor positive breast cancers

   Primer Sequence Nucleotide start site Product Lengths (bp)
     Full Deleted
PS4 sense AGGCGGAGATCGAGAACAAG 282 221 90
  antisense CCAGCACCTCAATTTCCTTC 503   
PS5 sense CAGGACGACGAGCAGAAGA 431 233 82
  antisense GGAGACTCGCTTGTCTTTGG 664   
PS6 sense AAGGAAATTGAGGTGCTGGA 485 185 163
  antisense CGTGTTGGAGACTCGCTTG 670   
PS7 sense TGATGAATTCACAGCAGACG 612 150 90
  antisense GTCTCCCCTGTCACCTTGTC 762   
PS8 sense ACAAGCGAGTCTCCAACACG 651 275 143
  antisense CCGCTTTGTGGATGAGTTC 926