Skip to main content

Table 2 Primer design: oligo nucleotide sequences

From: Cancer stem cells from a rare form of glioblastoma multiforme involving the neurogenic ventricular wall

Gene Sequences (5' to 3')
Beta-Actin F GCACCACACCTTCTACAATGAGC
Beta-Actin R TTGAAGGTAGTTTCGTGGATGCC
Beta-tubulin III F AACGAGGCGCTCTACGACATC
Beta-tubulin III R CTCCTCCTCGTCGTCTTCGTA
Bmi-1AS CATTGCTGCTGGGCATCGTAAG
Bmi-1 S GGAGACCAGCAAGTATTGTCCTTTTG
BMP4 F GTGAGGAGCTTCCACCACGA
BMP4 R ACTGGTCCCTGGGATGTTCTC
Cathepsin B F GCAGCCTCAGCCACCCAGAT
Cathepsin B R CCACCATTACAGCCGTCCCCACAC
Cathepsin L F CCGGGGAGGGCAGTTGAG
Cathepsin L R CCTTGAGGCCCAGAGCAGTC
Cav-1 F GGACATCTCTACACCGTTCCC
Cav-1 R TTATATTTCTTTCTGCAAGTT
Cav-2 F ATGGGGGCTGGAGACGGAGAAG
Cav-2 R TCAATCCTGGCTCAGTTGCAG
CD133 AS ACGCCTTGTCCTTGGTAGTGTTG
CD133 S CTGGGGCTGCTGTTTATTATTCTG
c-Myc F AAGGTCAGAGTCTGGATCAC
c-Myc R TAACTACCTTGGGGGCCTTT
CXCR4 F CACCGCATCTGGAGAACCA
CXCR4 R GCCCATTTCCTCGGTGTAGTT
Dach1 S AGGCTTTCGACCTGTTCCTGAA
Dach1 AS GCTGTCAGACCTGTTGGTGGAA
DCX AS GTTTCCCTTCATGACTCGGCA
DCX S AATCCCAACTGGTCTGTCAAC
EPHB1 S GAGATGGACAGCTCCAGAGG
EPHB1 AS CCAGCATGAGCTGGTGTAGA
EPHB2 S AAAATTGAGCAGGTGATCGG
EPHB2 AS TCACAGGTGTGCTCTTGGTC
EPHB3 S AGCAACCTGGTCTGCAAAGT
EPHB3 AS TCCATAGCTCATGACCTCCC
EFNB1 S GGAGGCAGACAACACTGTCA
EFNB1 AS GAACAATGCCACCTTGGAGT
EFNB2 S GCAAGTT-CTGCTGGATCAAC
EFNB2 AS AGGATG-TTGTTCCCCGAATG
EFNB3, S CTGAAATGCCCATGGAAAGA
EFNB3, AS ACGCCCAGCAAGAGCAGCGC
GAPDH S ACCACAGTCCATGCCATCAC
GAPDH AS TCCA CCACCCTGTTGCTGTA
GFAP S ACATCGAGATCGCCACCTAC
GFAP AS ACATCACATCCTTGTGCTCC
HIF1 S GTCGGACAGCCTCACCAAACAGAGC
HIF1 AS GTTAACTTGATCCAAAGCTCTGAG
IGF1R S ACGCCAATAAGTTCGTCCAC
IGF1R AS TCCATCCTTGAGGGACTCAG
Ki67 F GGAGGCAATATTACATAATTTCA
Ki67 R CAGGGTCAGAAGAGAAGCTA
MMP2 F CCA CGT GAC AAG CCC ATG GGG CCC C
MMP2 R GCA GCC TAG CCA GTC GGA TTT GAT G
MMP9 F CAACATCACCTATTGGATCC
MMP9 R CGGGTGTAGAGTCTCTCGCT
MMP13 F TGCTCGCATTCTCCTTCAGGA
MMP13 R ATGCATCCAGGGGTCCTGGC
MMP14 F CGCTACGCCATCCAGGGTCTCAAA
MMP14 R CGGTCATCATCGGGCAGCACAAAA
msi1 S GAGACTGACGCGCCCCAGCC
msi1 AS CGCCTGGTCCATGAAAGTGACG
Mucin9 F CATGACCGGTGGACTTTTCT
Mucin9 R TCCTGTGAACCTTTCCCAAC
Mucin18 F GTGTTGAATCTGTCTTGTGAA
Mucin18 R ATGCCTCAGATCGATG
Mucin24 F2 GTTAATACTACCTGCTTTTGGATAGAATGT
Mucin24 R2 CCACTTGACAATCACTAACTGTTGAG
NCAM1 AS GGTGTTGGAAATGCTCTGGT
NCAM1 S AGGAGACAGAAACGAAGCCA
Nestin GGCAGCGTTGGAACAGAGGTTGGA
Nestin R CTCTAAACTGGAGTGGTCAGGGCT
Notch1 F TGTTAATGAGTGCATCTCCAA
Notch1 R CATTCGTAGCCATCAATCTTGTCC
NSE AS GACAGTTG CAGGCCTTTTCTTC
NSE S CATCGA CAAGGCTGGCTACACG
Nucleostamin F CATGACCTGCCATAAGCGGT
Nucleostamin R CAATTACTCCAACCCGAATGGC
Pax6 F GAGCCTCATCTGAATCTTCTCCG
Pax6 R CGTCCATCTTTGCTTGGGAAATC
p53 S TTGGATCCATGTTTTGCCAACTGGCC
p53 AS TTGAATTCAGGCTCCCCTTTCTTGCG
PTEN F GGACGAACTGGTGTAATGATATG
PTEN R TCTACTGTTTTTGTGAAGTACAGC
SDF-1S GGGGGAATTCCATGAACGCCAAGGTCGTGGTC
SDF-1 AS GGGGTCTAGAGGGCATGGATGAATATAAGCTGC
Sox2 S ACCGGCGGCAACCAGAAGAACAG
Sox2 AS GCGCCGCGGCCGGTATTTAT
TIMP1 F ACT GGA AGC CCT TTT CAG AGC
TIMP1 R AAT TCC GAC CTC GTC ATC AGG
VEGF AS CGATCGTTCTGTATCAGTCTTTCC
VEGF S GAAGTGGTGAAGTTCATGGATGTC
  1. Note: F, forward; R, reverse; S: sense; AS, anti-sense. All the primers were described previously[104].