Skip to main content

Table 1 PCR primers and oligonucleotide sequences of constructs in luciferase reporter assay

From: Up-regulation of miR-224 promotes cancer cell proliferation and invasion and predicts relapse of colorectal cancer

Targets Type Primers Oligonucleotide sequence (5′-3′)
SMAD4
(site 1, site 2) WT1 Sense CACAACTCGAGAGGCACAAGGTTGGTTGCTA
   Antisense GGAAAAAAGCGGCCGCGACCTTCTGAGCAAGGCAGT
SMAD4 WT2 Sense CACAACTCGAGTGTGTGACACCACCCTCCTA
(site3)   Antisense AAGGAAAAAAGCGGCCGCTCAATCCAAGCCCGTGAGTC
SMAD4 MUT1 Sense TGATGCACTGAATTTTTGGTATAATGTTTAAATCATGT
(site1)   Antisense CCAAAAATTCAGTGCATCAAATCAAGTACAAAAATA
SMAD4 MUT2 Sense TGGCACACTGAATGTATAGAGAATTTAAGTAGAAAAGTT
(site2)   Antisense TATACATTCAGTGTGCCAATTGATATGATCATTGATGG
SMAD MUT3 Sense GATTAACACTGAATGGCTGGATCATTCAGAGCTCTCTTCT
(site3)   Antisense GCCATTCAGTGTTAATCAAAATGGACCTAAAAAGAGCCA