Skip to main content

Table 3 Primers used in real-time PCR

From: The expression and clinical significance of HERC4 in breast cancer

Primer ID Primer sequences(5′-3′)
HERC4-Forward TGATAGATGGGGGATTGTCG
HERC4-Reverse ACCCAGTGATTGGTGCTCAT
GAPDH-Forward CTGGGCTACACTGAGCACC
GAPDH-Reverse AAGTGGTCGTTGAGGGCAATG
  1. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, as internal control.