Skip to main content

Table 1 RT-qPCR primers used in the present study

From: MiR-145 inhibits oral squamous cell carcinoma (OSCC) cell growth by targeting c-Myc and Cdk6

Gene Primer sequences (5’-3’)
Cyclin D1 Forward primer: AGACCTTCGTTGCCCTCTGT
β-actin Forward primer: GCACAGAGCCTCGCCTT