Skip to main content

Advertisement

Table 1 RT-qPCR primers used in the present study

From: MiR-145 inhibits oral squamous cell carcinoma (OSCC) cell growth by targeting c-Myc and Cdk6

Gene Primer sequences (5’-3’)
MiR-145 RT primer: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACagggatt
  Forward primer: CAGTGCGTGTCGTGGAGT
  Reverse primer: AGGTCCAGTTTTCCCAGG
U6 RT primer: CGCTTCACGAATTTGCGTGTCAT
  Forward primer: GCTTCGGCAGCACATATACTAAAAT
  Reverse primer: CGCTTCACGAATTTGCGTGTCAT
c-Myc Forward primer: GCTGCTTAGACGCTGGATTT
  Reverse primer: CACCGAGTCGTAGTCGAGGT
Cyclin D1 Forward primer: AGACCTTCGTTGCCCTCTGT
  Reverse primer: AGTTGTTGGGGCTCCTCAG
Cdk6 Forward primer: TGGAGACCTTCGAGCACC
  Reverse primer: CACTCCAGGCTCTGGAACTT
β-actin Forward primer: GCACAGAGCCTCGCCTT
  Reverse primer: GTTGTCGACGACGAGCG