Skip to main content

Table 1 Primer sequences for target genes

From: Genistein promotes cell death of ethanol-stressed HeLa cells through the continuation of apoptosis or secondary necrosis

Gene symbol Forward Primer (5’ to 3’) Product size
Reverse Primer (5’ to 3’c
BCL2 ATGTCCAGCCAGCTGCACCTGAC 319 bp
GCAGAGTCTTCAGAGACAGCCAGG
MDM2 CCCTGGTTAGACCAAAGCCAT 190 bp
GGCACGCCAAACAAATCTCC
GAPDH CATGAGAAGTATGACAACAGCCT 113 bp
AGTCCTTCCACGATACCAAAGT
XIAP GGGTTCAGTTTCAAGGACATTAAG 182 bp
CGCCTTAGCTGCTCTTCAGTAC
ATF3 AACCTGACGCCCTTTGTCAAG 138 bp
TACCTCGGCTTTTGTGATGGA
BAX GATGCGTCCACCAAGAAGCT 170 bp
CGGCCCCAGTTGAAGTTG
MCL1 TAAGGACAAAACGGGACTGG 137 bp
ACCAGCTCCTACTCCAGCAA
TP53 GAGGTTGGCTCTGACTGTACC 133 bp
TCCGTCCCAGTAGATTACCAC
CREB1 TTAACCATGACCAATGCAGCA 140 bp
TGGTATGTTTGTACGTCTCCAGA
PUMA GACCTCAACGCACAGTACGAG 98 bp
AGGAGTCCCATGATGAGATTGT
NOXA ATGCCTGGGAAGAAGGCGC 164 bp
CAGGTTCCTGAGCAGAAGAGT