Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer sequences

From: Oncogenic transformation of mammary epithelial cells by transforming growth factor beta independent of mammary stem cell regulation

mRNA Forward Reverse
Snail gtctgcacgacctgtggaa caggagaatggcttctcacc
Zeb2 ccagaggaaacaaggatttca aggcctgacatgtagtcttgtg
Sfrp1 gctgctcaacaagaactgccacat acatttgagcatctcgggccagta
Pgk1 tgactttggacaagctggacgtga tgagttcagcagcaactggctcta