Skip to main content

Advertisement

Figure 3 | Cancer Cell International

Figure 3

From: Epigenetic inactivation and aberrant transcription of CSMD1 in squamous cell carcinoma cell lines

Figure 3

RT-PCR data demonstrating the preferential loss of longer CSMD1 transcripts in cell line PCI-100. Exons 1 and 2 were amplified with prm1542 (gggacccgatgctatgagagggaag) and prm1482 (cccgtgaggaaaccctgggctct), exons 2 through 4 with prm2078 (gggcgagcgcaataggatacagtt) and prm1382 (ggatggcgtggccttccaagatgtag), exons 4 through 6 with prm1392 (agctgcctccctggctacatcttgg) and prm1405 (cttggaactgagcgttaaatcctttg), and exons 7 through 11 with prm1463 (tgaaaaaggcgattgagttgaagtc) and prm1421 (gaccgatctggtgtctcccaccttc). "STD" indicates a lane of DNA standards whose sizes are given on the left side of the figure, "HFB" = human fetal brain, "blank" indicates a control reaction with water substitute for cDNA.

Back to article page