Skip to main content

Advertisement

Table 1 PCR primers used for COBRA analysis of CSMD1 CpG island

From: Epigenetic inactivation and aberrant transcription of CSMD1 in squamous cell carcinoma cell lines

PCR round forward   reverse   annealing temp [MgCl2] (mM) amplicon size (bp) # of CpG's # BstU1 sites # Taq1 sites
Amplicon 1           
1 st prm1998 taagttaggtagggggttgtttt prm1999 aaccactacaaaactaaactact 45°C 1.5 626    
2 nd prm2000 ggaagggagattaaaggatgg prm2001 aaactcaaccatccttacccacaa 58°C 1.5 298 19 1 4
Amplicons 2 and 3           
1 st prm1942 gagtagtttagttttgtagtggt prm1943 tattaaattcctttctccttaaca 45°C 2.0 594    
2 nd prm2006 agtagtttagttttgtagtggtt prm2007 caatcatatctacaaatactcc 45°C 2.0 225 20 2 1
2 nd prm1954 tgtggagtatttgtagatatgattg prm1968 cctttctccttaacaccctatacta 55°C 1.5 388 31 4 1