Skip to main content

Advertisement

Table 1 DNA sequences of all primers used in methylation sensitive PCR

From: Down-regulation of DNMT3b in PC3 cells effects locus-specific DNA methylation, and represses cellular growth and migration

GENE METHYLATED PRIMER SEQUENCE UNMETHYLATED PRIMER SEQUENCE
RASSF1A F 5' GTGTTAACGCGTTGCGTATC 3' F 5'TTTGGTTGGAGTGTGTTAATGTG 3'
  R 5' AACCCCGCGAACTAAAAACGA 3' R CAAACCCCACAAACTAAAAACAA 3'
Survivin F 5' GGCGGGAGGATTATAATTTTCG 3' F 5' GGTGGGAGGATTATAATTTTTG 3'
  R 5' CCGCCACCTCTACCAACG 3' R 5' CCACCACCACCACCTCTAC 3'
DAPK1 F 5'GGATAGTCGGATCGAGTTAACGTC 3' F 5'GGATAGTTGGATTGAGTTAAYGTC 3'
  R 5' CCCTCCCAAACGCCGA 3' R 5' CAAATCCCTCCCAAACACCAA 3'
APC F 5' TATTGCGGAGTGCGGGTC 3' F 5' GTGTTTTATTGTGGAGTGTGGGTT 3'
  R 5' TCGACGAACTCCCGACGA 3' R 5' CCAATCAACAAACTCCCAACAA 3'
RAR-β F 5' TCGAGAACGCGAGCGATTCG 3' F 5' TTGAGAATGTGAGTGATTTGA 3'
  R 5' GACCAATCCAACCGAAACGA 3' R 5' AACCAATCCAACAAAACAA 3'
hLMH1 F 5'ACGTAGACGTTTATTAGGGTCGC 3' F 'TTTTGATGTAGATGTTTTATTAGGGTTGT 3'
  R 5'CCTCATCGTAACTACCGCG 3' R 5'ACCACCTCATCATAACTACCCACA 3'
RB1 F 5'GGGAGTTTCGCGGACGTGAC 3' F 5'GGGAGTTTTGTGGATGTGAT 3'
  R 5'ACGTCGAAACACGCCCCG 3' R 5'ACATCAAAACAACCCCA 3'
BRCA F 5'GGTTAATTTAGAGTTTCGAGAGACG 3' F 5' GGTTAATTTAGAGTTTTGAGAGATG 3'
  R 5' TCAACGAACTCACGCCGCGCAATCG 3' 5' TCAACAAACTCACACCACACAATCA 3'
TIMP3 F 5' CGTTTCGTTATTTTTTGTTTTCGGTTTC 3' F 5' TTTTGTTTTGTTATTTTTTGTTTTTGGTTTT 3'
  R 5' CCGAAAACCCCGCCTCG 3' R 5' CCCCCAAAAACCCCACCTCA 3'
VHL F 5' TGGAGGATTTTTTTGCGTACGC 3' F 5' GTTGGAGGATTTTTTTGTGTATGT3'
  R 5' GAACCGAACGCCGCGAA 3' R 5' CCCAAACCAAACACCACAAA 3'
p16 F 5' TTATTAGAGGGTGGGGCGGATCGC 3' F 5' TTATTAGAGGGTGGGGTGGATTGT 3'
  R 5' ACCCCGAACCGCGACCGTAA 3' F 5' CAACCCCAAACCACAACCATAA 3'
PTEN F 5' GGTTTTTCGAGGCGTTCG 3' F 5' TGGTTTTTTGAGGTGTTTG 3'
  R 5' CGCCTCACAACGACTCAACT 3' R 5' TTCCATCATAACTACAACTTCCA 3'
CDH1 F 5' GTGGGCGGGTCGTTAGTTTC 3' F 5' GGTGGGTGGGTTGTTAGTTTTGT 3'
  R 5' CTCACAAATACTTTACAATTCCGACG 3' R 5' AACTCACAAATCTTTACAATTCCAAC 3'
CASP8 F 5' TAGGGGATTCGGACATTGCGA 3' F 5' TAGGGGATTTGGAGATTGTGTA 3'
  R 5' CGTATATCTACATTCGAAACG 3' R 5' CCATATATATCTACATTCAAAACAA 3'
hTERTc F 5' GACGTAAAGTTTTTTTCGGACG 3' F 5' GTAAAGATGTAAAGTTTTTTTTGGATG 3'
  R 5' ACCCGATACGCTACCGAACG 3' R 5' CCACAACCCAATACACTACCA 3'
RASSF1c F 5' AGTTTGGATTGTCGGTTTCG 3' F 5' GGAGTTTGGATTGTTGGTTTTG 3'
  R 5' TCACAAACCCCACCTACCAC 3' R 5' CACCCCCAAAAATAACCTCAT 3'
  1. DNA sequences of methylated and unmethylated set of primers of 16 tumor suppressor genes studied by methylation-specific PCR.