Skip to main content

Table 2 Oligonucleotides used for PCR amplification

From: Inhibition of androgen-independent prostate cancer cell growth is enhanced by combination therapy targeting Hedgehog and ErbB signalling

Gene Sequence 5'-3' Size of product (Base Pairs)
AR-f GACGCTTCTACCAGCTCACC 60
AR-r GAAAGGATCTTGGGCACTTG  
β-actin-f GATGAGATTGGCATGGCTTT 60
β-actin-r CACCTTCACCGTTCCAGTTT  
DD3PCA3 GGTGGGAAGGACCTGATGATAG 58
DD3PCA3 GGGCGAGGCTCATCGAT  
ErbB2-f CCTCTGACGTCCATCGTCTC 100
ErbB2-r CGGATCTTCTGCTGCCGTCG  
EGFR-f CTTCTTGCAGCGATACAGCTC 439
EGFR-r ATGCTCCAATAAATTCACTGC  
GLI1-f GAAGACCTCTCCAGCTTGGA 306
GLI1-r GGCTGACAGTATAGGCAGAG  
GREX-f* GAGTACCTCTGGAGGACAGA 281
GRINTRON-r* ATGTCCATTCTTAAGAAACAGGA  
PSA-f GGTGACCAAGTTCATGCTGTG 194
PSA-r GTGTCCTTGATCCACTTCCG  
PTCH-1-f CTCCCAAGCAAATGTACGAGCA 150
PTCH-1-r TGAGTGGAGTTCTGTGCGACAC  
β2-microglobulin-f TGAATTCGTATGTGTCTGGGT 247
β2-microglobulin-r CCTCCATGATGCTGCTTACAT  
  1. * GREX/GRINTRON = glucocorticoid receptor intron genomic DNA control. Sequence for GRINTRON crosses boundary of glucocorticoid receptor gene intron and exon. No product is formed unless genomic DNA is present.