Skip to main content

Advertisement

Table 3 Primers used for RT-PCR and BSP

From: HOXA11 gene is hypermethylation and aberrant expression in gastric cancer

Primers Sense sequences 5′-3′ Antisense sequences 5′-3′ Product size (bp) Annealing temperature(°C)
HOXA11 RT-PCR TATACCAAGTACCAGATCCGA TGAGATCTTAATCAAGAGAGT 374 50
HOXA11 BSP ATTTTTATATGTAAGAAATTG AAAGTTTCCATTCTAAACAAT 276 50
β-actin CACTGGCATCGTGATGGA GGCCATCTCTTGCTCGAA 210 56