Skip to main content

Advertisement

Table 1 Primer sequences, product size, and annealing temperature

From: The effects of phenoxodiol on the cell cycle of prostate cancer cell lines

Gene Sequence Product size (base pairs) Annealing temperature
AIF Forward: GATCACGCTGTTGTGAGTGG 179 bp 61°C
Reverse: TCTTGTGCAGTTGCTTTTGC
β-Catenin Forward: GATTTGATGGAGTTGGAC 218 bp 52°C
Reverse: TGTTCTTGAGTGAAGGAC
Bax Forward: GCTGGACATTGGACTTCCTC 167 bp 61°C
Reverse: TCAGCCCATCTTCTTCCAGA
Bcl-xL Forward: ACAATGCAGCAGCCGAGAG 167 bp 61°C
Reverse: ATGTGGTGGAGCAGAGAAGG
Caspase 3 Forward: AAGGATCCTTAATAAAGGTATCCATGGAGAACACT 322 bp 55°C
Reverse: AAAGAATTCCATCACGCATCAATTCCACAATTTCTT
Cyclin-D1 Forward: AACTACCTGGACCGCTTCCT 165 bp 62°C
Reverse: CCACTTGAGCTTGTTCACCA
GAPDH Forward: CAGAACATCATCCCTGCATCCACT 185 bp 60°C
Reverse: GTTGCTGTTGAAGTCACAGGAGAC
Ki-67 Forward: AGTCAGACCCAGTGGACACC 225 bp 60°C
Reverse: TGCTGCCGGTTAAGTTCTCT
L19 Forward: CTGAAGGTCAAAGGGAATGTG 194 bp 52°C
Reverse: GGACAGAGTCTTGATGATCTC
p21 WAF1 Forward: CCGAAGTCAGTTCCTTGTGG 333 bp 61°C
Reverse: AAGTCGAAGTTCCATCGCTCA
sFRP4 Forward: CGATCGGTGCAAGTGTAAAA 181 bp 56°C
Reverse: GACTTGAGTTCGAGGGATGG
XIAP Forward: GGGGTTCAGTTTCAAGGACA 183 bp 56°C
Reverse: CGCCTTAGCTGCTCTTCAGT