Skip to main content

Advertisement

Table 1 Human primer sequences used for RT-PCR

From: Nucleofection optimization and in vitro anti-tumourigenic effect of TRAIL-expressing human adipose-derived mesenchymal stromal cells

Gene Accession Sense primer Antisense primer Product Size (bp)
Nestin NM_006617.1 CAGCGTTGGAACAGAGGTTGG TGGCACAGGTGTCTCAAGGGTAG 389
BMP 4 NM_130851.2 GTCCTGCTAGGAGGCGCGAG GTTCTCCAGATGTTCTTCG 338
Rex-1 NM_174900 GCGTACGCAAATTAAAGTCCAGA ATCCTAAACCAGCTCGCAGAAT 282
Gata-2 NM_001145661.1 AGCCGGCACCTGTTGTGCAA TGACTTCTCCTGCATGCACT 243
TDGF NM_003212.3 GCCCGCTTCTCTTACAGTGTGATT AGTACGTGCAGACGGTGGTAGTTCT 497
Sox 2 NM_003106.3 CCCCCGGCGGCAATAGCA TCGGCGCCGGGGAGATACAT 447
Leptin NM_000230.2 TGTGCCCATCCAAAAAGTCC GTTTGGAGGAGACTGACTGCG 100
PPARγ NM_015869.4 GAGCACTTCACAAGAAATTACC AATGCTGGAGAAATCAACTG 151
ALP NM_000478.4 GGAAGGGTCAGTCAGGTT GTGGGCCGCTCTAGGCACCAA 500
Osteocalcin NM_199173.4 ATGAGAGCCCTCACACTCCTC GCCGTAGAAGCGCCGATAGGC 294
TRAIL NM_003810.2 TTGTTGATGAAAAGTGCTAGAAATA ATGGTCCATGTCTATCAAGTGC 150
GAPDH NM_002046.4 TGAAGGTCGGAGTCAACGGATT CATGTGGGCCATGAGGTCCACCAC 530