Skip to main content

Advertisement

Table 1 Primer sets for RT-qPCR analysis

From: Acidic extracellular pH promotes epithelial mesenchymal transition in Lewis lung carcinoma model

Gene   Sequences Product size (bp) Accession number*
β-actin Forward: 5′-CATCCGTAAAGACCTCTATGCCAAC-3′ 186 NM_007393
Reverse: 5′-ATGGAGCCACCGATCCACA-3′
Mmp2 Forward: 5′-AGGCAGTAGAGTAAGGGGATCG-3′ 279 NM_008610.2
Reverse: 5′-TAGAAAGTGTTCAGGTATTGCACTG-3′
Mmp3 Forward: 5′-TGAAGCATTTGGGTTTCTCTACT-3′ 134 NM_010809
Reverse: 5′-GATGCCTTCCTTGGATCTCTTT-3′
Mmp9 Forward: 5′-GCCCTGGAACTCACACGACA-3′ 85 NM_013599
Reverse: 5′-TTGGAAACTCACACGCCAGAAG-3′
Mmp13 Forward: 5′-TCCCTGGAATTGGCAACAAAG-3′ 120 NM_008607.2
Reverse: 5′-GCATGACTCTCACAATGCGATTAC-3′
Mmp14 Forward: 5′-TCTTCAAGGAGCGATGGTTCT-3′ 182 NM_008608.3
Reverse: 5′-CAGGGAGGCTTCGTCAAACA-3′
Vim Forward: 5′-GGACGTTTCCAAGCCTGACCTC-3′ 198 NM_011701
Reverse: 5′-CCGGTACTCGTTTGACTCCTGC-3′
Cdh1 Forward: 5′- ATTGCAAGTTCCTGCCATCCTC -3′ 145 NM_009864
Reverse: 5′-CACATTGTCCCGGGTATCATCA-3′
Cdh3 Forward: 5′-TCGTGAGGACGAGCAGTTTG-3′ 130 NM_007665
Reverse: 5′-GCCATGGTCGTTGATGTCAG-3′
Snail Forward: 5′-AGGACGCGTGTGTGGAGTTC-3′ 235 NM_011427
Reverse: 5′-TGGGAGCTTTTGCCACTGTC-3′
Slug Forward: 5′-CATTCGAACCCACACATTGCC-3′ 112 NM_011415
Reverse: 5′-AGAGAAAGGCTTTTCCCCAGTG-3′
Twist1 Forward: 5′-GCCGGAGACCTAGATGTCATTG-3′ 149 NM_011658
Reverse: 5′-ACGCCCTGATTCTTGTGAATTTG-3′
Twist2 Forward: 5′-GCAAGCCAGGACCCACC-3′ 100 NM_007855
Reverse: 5′-GTCATGAGGAGCCACAAGGT-3′
Zeb1 Forward: 5′-GCTGGCAAGACAACGTGAAAG-3′ 116 NM_011546
Reverse: 5′-AGGATAAATGACGGCGGTGT-3′
Zeb2 Forward: 5′-AGACTTCACAGATCGAGCCT-3′ 146 NM_015753
Reverse: 5′-CCTCCTGGGATTGGCTTGTT-3′
  1. *Accession number of the National Center for Biotechnology Information (NCBI).