Skip to main content

Advertisement

Table 1 Primer for PCR amplification and siRNAs sequences

From: STAT1 inhibits human hepatocellular carcinoma cell growth through induction of p53 and Fbxw7

Sequencing primers 5′–3′
p53-F primer CAGATCCCTTAGTTTTGGGTGC
p53-R primer GCCTGGAGAGACCTAGACCA
Fbxw7-F primer AAAGAGTTGTTAGCGGTTCTCG
Fbxw7-R primer CCACATGGATACCATCAAACTG
HES-1-F primer CCAAAGACAGCATCTGAGCA
HES-1-R primer TCAGCTGGCTCAGACTTTCA
NF-κB p65-F primer TCTGCAACTGAAACGCAAGC
NF-κB p65-R primer CTCCACAGCTTCTCTTACCTT
CDK2-F primer CGGATCTTTCGGACTCTGGG
CDK2-R primer GAGAGGGTGAGCCGATTAGG
CyclinA-F primer CAGAGGCCGAAGACGAGAC
CyclinA-R primer TCAGCTGGCTTCTTCTGAGC
CyclinD1-F primer CTGGCCATGAACTACCTGGA
CyclinD1-R primer GTCACACTTGATCACTCTCC
CyclinE-F primer GTTATAAGGGAGACGGGGAG
CyclinE-R primer TGCTCTGCTTCTTACCGCTC
RITA-F primer GGGTGGAGAAGGCTAACAGAA
RITA-R primer CATCACAGTAAGACGGGGTGT
GAPDH-F primer AGGTGAAGGTCGGAGTCAAC
GAPDH-R primer CGCTCCTGGAAGATGGTGAT
siRNA1:STAT1_homo-575 sense GCUGGAUGAUCAAUAUAGUTT
siRNA1:STAT1_homo-575 antisense ACUAUAUUGAUCAUCCAGCTT
siRNA2:STAT1_homo-647 sense GCGUAAUCUUCAGGAUAAUTT
siRNA2:STAT1_homo-647 antisense AUUAUCCUGAAGAUUACGCTT
siRNA3:STAT1_homo-1601 sense GCACCUGCAAUUGAAAGAATT
siRNA3:STAT1_homo-1601 antisense UUCUUUCAAUUGCAGGUGCTT
Control-siRNA-sense UUCUCCGAACGUGUCACGUTT
Control-siRNA-antisense ACGUGACACGUUCGGAGAATT