Skip to main content

Table 1 List of CYBR green primers used in current study

From: Bone morphogenetic protein 2 (BMP2) induces growth suppression and enhances chemosensitivity of human colon cancer cells

No Name Sequence
1 CASP10 F 5′ GAAGCCTTACCGCAGGAGTC 3′
R 5′ GTGCACCATTTGTGGCTCTG 3′
2 HDAC4 F 5′ ACTGGTACGGGAAAACGCAG 3′
R 5′ TTTGGCGTCGTACATTCCCA 3′
3 MAPK9 F 5′ TGGGCTACAAAGAGAACGTTGAT 3′
R 5′ AAGGTCGCGGGGAAGGATA 3′
4 MDM2 F 5′ AGGAGATTTGTTTGGCGTGC 3′
R 5′ TGAGTCCGATGATTCCTGCTG 3′
5 WNT7A F 5′ ATGCCCGGACTCTCATGAAC 3′
R 5′ GTTCTCCTCCAGGATCTTTCGG 3′
6 WNT3 F 5′ GGACAAAGCTACCAGGGAGT 3′
R 5′ CTGCACATGAGCGTGTCACT 3′
7 WNT4 F 5′ CATGAGTCCCCGCTCGTG 3′
R 5′ CCAGGTACAGCCAGTTGCTC 3′
8 SMAD4 F 5′ GGATACGTGGACCCTTCTGG 3′
R 5′ TGTGCAACCTTGCTCTCTCAA 3′
9 TERT F 5′ GGCACGGCTTTTGTTCAGAT 3′
R 5′ TCCGGGCATAGCTGGAGTAG 3′
10 AFT3 F 5′ GTGAGTCCTCGGTGCTCG 3′
R 5′ GCATCATTTTGCTCCAGGCT 3′
11 HOMEZ F 5′ CTGGACTGCGCTATCTCTGAAG 3′
R 5′ TGAACTACTGAGACCGCTGG 3
12 FADD F 5′ GGGAAGAAGACCTGTGTGCAG 3′
R 5′ GAGCCAGCCTTCTCCAATCT 3′
13 BCL2 F 5′ AGATTGATGGGATCGTTGCCT 3′
R 5′ AGTCTACTTCCTCTGTGATGTTGT 3′
14 BIRC5 F 5′ AGCCAAGAACAAAATTGCAAAGG 3′
R 5′ CGCACTTTCTCCGCAGTTTC 3′
15 E2F1 F 5′ AACTGACCATCAGTACCTGGC 3′
R 5′ GGGATTTCACACCTTTTCCTGG 3′
16 E2F2 F 5′ AGGAGCAGACAGTGATTGCC 3′
R 5′ GGTTGTCCTCAGTCCTGTCG 3′
17 BMP2 F 5′ GGAACGGACATTCGGTCCTT 3′
R 5′ CACCATGGTCGACCTTTAGGA 3′
18 GAPDH F 5′ CTGGTAAAGTGGATATTGTTGCCAT 3′
R 5′ TGGAATCATATTGGAACATGTAAACC 3′
\