Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 The sequences of the primers used for quantitative real-time PCR

From: HNRNPA2B1 regulates the epithelial–mesenchymal transition in pancreatic cancer cells through the ERK/snail signalling pathway

Gene Forward primer Reverse primer
β-actin GACATCCGCAAAGACCTG GGAAGGTGGACAGCGAG
HNRNPA2B1 ATGGCTGCAAGACCTCATTC TAATTCCGCCAACAAACAGC
E-cadherin GACCGAGAGAGTTTCCCTAC GGTGGGATTGAAGATCGGAG
N-cadherin GTGACCGATAAGGATCAACC TTGACCACGGTGACTAACCC
Vimentin GGATGTTGACAATGCGTCTC CTCCTGGATTTCCTCTTCGT
Mmp7 TGAGGATGAACGCTGGACG CACTGCATTAGGATCAGAGGAA
Mmp9 AGTCCACCCTTGTGCTCTTC GCCACCCGAGTGTAACCAT
ERK ATCCCCATCACAAGAAGA GCTTTGGAGTCAGCATTT
Snail CTTCTCCTCTACTTCAGTCTCTTCC TGAGGTATTCCTTGTTGCAGTATTT