Skip to main content

Advertisement

Table 1 List of oligonucleotide primers

From: Human basonuclin 2 up-regulates a cascade set of interferon-stimulated genes with anti-cancerous properties in a lung cancer model

Gene Forward primer Reverse primer
Esterase D (ESD) ATTTGCTCCAATTTGCAACC TCACAAGGTGGGTAGCATCA
Basonuclin 2 (BNC2) TGTGAAACTTCACTACAGGAACG GAGGCGTCTTCCCTGACATC
Guanylate binding protein 1, interferon-inducible (GBP1) CCAGATGACCAGCAGTAGAC AAGCTAGGGTGGTTGTCCTT
Myxovirus (influenza virus) resistance 2 (mouse) (MX2) TGAGTGCTGTGTAAGTGATGG GGACCGGCTAACAGTCACTA
2′-5′-oligoadenylate synthetase 2, 69/71 kDa (OAS2) GGTAGCGCATCTTGATTCCA GAGTATGTAGGGTGGCAAGC
Interferon regulatory factor 7 (IRF7) ATCTTCAAGGCCTGGGCTG CAGCGGAAGTTGGTTTTCCA
Interferon induced transmembrane protein 1 (IFITM1) CTGCAACCTTTGCACTCCA TGTAGACAGGTGTGTGGGTA
Aconitase 1, soluble (ACO1) GCTCACAGGGCAAGAACGAT TCATGACAGCCTGGAAGGTC
Differentiation antagonizing non-protein coding RNA (DANCR) ACTATGTAGCGGGTTTCGGG TTCCGCAGACGTAAGAGACG
Leucine rich repeat containing 20 (LRRC20) CTGCTTGGAGAGTTTGCCCT GCTTAGGGGCTCACTCACTG
5′-nucleotidase domain containing 2 (NT5DC2) CATCTTCCGCACCTTCCACA TGAAGTCCACGCGGTAGTTG
Thioredoxin domain containing 12 (endoplasmic reticulum) (TXNDC12) GCTTGAGCTTCCCTGTTTGC TGGCTACACCTAGGGCTTGA
2′-5′-oligoadenylate synthetase 1, 40/46 kDa (OAS1) CGGACCCTACAGGAAACTTG GAGGTCTCACCAGCAGAATC
2′-5′-oligoadenylate synthetase 3, 100 kDa (OAS3) AGAGTTCTGAGCAGGGCCTA TGGAAAGAGCCACCTAACTGC
2′-5′-oligoadenylate synthetase-like (OASL) ATTCCAAGGCCAAGTCCTG TCTTCGAGAGGATGAGAGTGT
XIAP associated factor 1 (XAF1) GGTTTGCCCAAGGACTACAA GGGTGTAGGATTCTCCAGGT