Skip to main content

Table 3 Primers used in determining mRNA expression of significantly regulated genes

From: The cholesterol metabolite 27-hydroxycholesterol stimulates cell proliferation via ERβ in prostate cancer cells

Gene Sequence
CBX1-f TGAGCAGCGTCACCCTTTACAC
CBX1-r CCACTTTGCCCTTTACCACTCG
CBX5-f TGGCACAATCTTGGCTTACTGT
CBX5-r ATGGTGGCACACACCTGTAGTC
CTGF-f AGGATGTGCATTCTCCAGCCATC
CTGF-r TGTCAGAGCTGAGTCTGCTGTTC
CYP27A1-f CAGCTGCGCTTCTTCTTTCAGC
CYP27A1-r TGGCCTTGTAAAGCACCTGTAAC
FOXA1-f TCCTCAGGAATTGCCCTCAAGAAC
FOXA1-r ATGACATGACCATGGCACTCTGC
GLI2-f TGTCTGAGTGACACCAACCAGAAC
GLI2-r TGTGAATGGCGACAGGGTTGAC
GLI3-f CCTCCAGCACCACTTCTAATGAGG
GLI3-r TCTGTGGCTGCATAGTGATTGCG
IGFBP3-f TCCAAGCGGGAGACAGAATATGG
IGFBP3-r AGGAACTTCAGGTGATTCAGTGTG
INSIG2-f CATGCCAGTGCTAAAGTGGATTTC
INSIG2-r TGGATAGTGCAGCCAGTGTGAG
MDM2-f TCCTCTCAAGCTCCGTGTTTG
MDM2-r TCATGATGTGGTCAGGGTAGATG
MTA3-f GCAGCAGAAGCTGAGAGTAAACTG
MTA3-r TGGTTGGGATTTGGTTTGCTGTAG
NR1H2-f GCATCCACTATCGAGATCATGCTG
NR1H2-r GAAGGTGATACACTCTGTCTCGTG
OSBP-f CTATGAAAGCCACAGAGGATGGC
OSBP-r GTCCTTCTTCCGCTCAAACCAC
PTCH1-f TCACCGTTCACGTTGCTTTGGC
PTCH1-r AAACATGTGCTCCAGGGCAAGC
RXRB-f TGCTGTGGAACAGAAGAGTGACC
RXRB-r ATGTTAGTCACAGGGTCATTTGGG
SIRT1-f ACAGGTTGCGGGAATCCAAAGG
SIRT1-r CCTAGGACATCGAGGAACTACCTG
SPARC-f TGGCGAGTTTGAGAAGGTGTGC
SPARC-r TGGCAAAGAAGTGGCAGGAAGAG
SRD5A2-f ACATACGGTTTAGCTTGGGTGTC
SRD5A2-r TTTCTCCAGGCTTCCTGAGCTG
SREBF1-f GCCATGGATTGCACTTTCGAAGAC
SREBF1-r GGTCAAATAGGCCAGGGAAGTCAC
TAF3-f GCCATCGGTACTCTGAGCTCTATG
TAF3-r TGACGGAATTTGGTGTGGGAAGG
TFF1-f GCCCCCCGTGAAAGACA
TFF1-r CGTCGAAACAGCAGCCCTTA
TMPRSS2-f TGTGGTCCCTTCCAATGCTGTG
TMPRSS2-r TGCTCATGGTTATGGCACTTGGC
TNF-f CCAGGCAGTCAGATCATCTTCTCG
TNF-r ATCTCTCAGCTCCACGCCATTG
TP53-f AGTGGAAGGAAATTTGCGTGTGG
TP53-r TGGTACAGTCAGAGCCAACCTC
VEGFA-f AGGGCAGAATCATCACGAAGTGG
VEGFA-r AGGGTCTCGATTGGATGGCAGTAG
ACTINalpha-f CAGGACCGTGTGGAGCAGATTG
ACTINalpha-r CAGATTGTCCCACTGGTCACAG
B2M-f TGAGTATGCCTGCCGTGTGAAC
B2M-r TGCTGCTTACATGTCTCGATCCC