Skip to main content

Advertisement

Table 1 Materials

From: ARNT is a potential direct HIF-1 target gene in human Hep3B hepatocellular carcinoma cells

Antibodies Description Application
Anti-ARNT Mouse monoclonal, clone 2B10, #NB300-525, Novus Biologicals ChIP, WB
Anti-HIF-1α Mouse monoclonal, clone H1α67, #NB100-123, Novus Biologicals ChIP
Anti-HIF-1α Mouse monoclonal, clone 54, #610959, BD Transduction Laboratories™ WB
Anti-histone H3 Rabbit monoclonal, clone D2B12, #4620, Cell Signaling Technology ChIP
Anti-Lamin A/C Goat polyclonal, #sc-6215, Santa Cruz WB
IgG Isotype control, rabbit, #2729, Cell Signaling Technology ChIP
Oligos Sequence  
Target 1 top GATTACAGGCATGCGCCACCACGCCGTTTT  
Target 1 bottom GGCGTGGTGGCGCATGCCTGTAATCCGGTG  
Target 2 top TTCGAACCCCTGGCCACAGGTGATCGTTTT  
Target 2 bottom GATCACCTGTGGCCAGGGGTTCGAACGGTG  
Primer Sequence  
Region 1 for CAACGTCGTGAAACTCCATC  
Region 1 rev TGCCTCAGTCTCCTGAGTAG  
Region 2 for ACGGAGTTTCGCTCTTGTTG  
Region 2 rev CCTGTAATCCCAGCTTCTTG  
Region 3 for TGCCTCAGCCTCCCAAGAAG  
Region 3 rev CGCGTCTGTAATCCCAGCAC  
RPL30 #7014, Cell Signaling Technology  
U6 sequencing GGACTATCATATGCTTACCG  
VEGF HRE for CAGTTCCCTGGCAACATCTG  
VEGF HRE rev CAGTGACTGGGAGGGAAGAG