Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 PCR primers of CRMP4 promoter and sequencing primers

From: Collapsin response mediator protein 4 promotor methylation level as a potential predictor for diagnosing primary malignant lymphoma of the prostate

CPG1
 CZ-G1-F1 ATAGGGAATGGTTGAGTTTATTGT
 CZ-G1-R1-Bio Biotin-ACCCCCTCTCCTCTACCATA
 CZ-G1-S1 GTTTTTTGTAGTTTTTGAGA
 CZ-G1-S2 AGTTTTTTTTTAGAATAAAG
 CZ-G1-S3 TTTAGGAGTTTGAAGGG
 CZ-G1-S4 GTTTAGGGTTTGGGGA
 CZ-G1-S5 GGGAATGGTTGAGTTTA
CPG2
 CZ-G2-F2 AGGGTTTGGGGATTTTAGTAGGT
 CZ-G2-R2-Bio Biotin-TCCCCAAAATAAAAACATCAACT
 CZ-G2-S6 TAGAGTTATGGTAGAGGAGAG