Skip to main content

Advertisement

Table 2 List of primers

From: Study of the tumor microenvironment during breast cancer progression

No. Gene code Forward Melting point of amplicon
Reverse
1 T.bet 5′CCAACAATGTGACCCAGATGATT3′ 85
5′TATGCGTGTTGGAAGCGTTG3′
2 IL-12p40 5′GCCCAGAGCAAGATGTGTCA3′ 82
5′GGGCATCCGGATACCAATC3′
3 IFN-γ 5′TCAGCTCTGCATCGTTTTGG 3′ 79
5′GTTCCATTATCCGCTACATCTGAA3′
4 GATA3 5′CCCTACTACGGAAACTCGGTCA3′ 88
5′GTAGGGATCCATGAAGCAGAGG3′
5 IL-4 5′CAAGCAGCTGATCCGATTCC3′ 81
5′TTCTCTCTCATGATCGTCTTTAGCC3′
6 IL-5 5′CCTGTTCCTGTACATAAAAATCACCA3′ 80
5′TTGAATAGTCTTTCCACAGTACCCC3′
7 RORC 5′ACAGCACCGAGCCTCACG3′ 85
5′CAGACGACTTGTCCCCACAGA3′
8 IL-17 5′TTGATTGGAAGAAACAACGATGACT3′ 81
5′TGGATTTCGTGGGATTGTGAT3′
9 CCL22 5′TGCCGTGATTACGTCCGTTA3′ 87
5′CGGCACAGATCTCCTTATCCC3′
10 FOXP3 5′ACAGCACATTCCCAGAGTTCCT3′ 82
5′GATGAGCGTGGCGTAGGTG3′
11 CTLA4 5′TGGATCCTTGCAGCAGTTAGTTC3′ 79
5′CATTTTCACATAGACCCCTGTTGTA3′
12 IL-13 5′AGGTCTCAGCTGGGCAGTTTT3′ 80
5′TAATGATGCTTTCGAAGTTTCAGTTG3′
13 STAT3 5′CTCAAGAGTCAAGGAGACATGCA3′ 85
5′CTCACTCACGATGCTTCTCCG3′
14 FASL 5′CTCCGAGAGTCTACCAGCCAGAT3′ 84
5′CATGGACCTTGAGTTGGACTTG3′
15 CCR7 5′GTGGTGGCTCTCCTTGTCATTT3′ 84
5′ATGATAGGGAGGAACCAGGCTT3′
16 IL-6 5′CCTGAGAAAGGAGACATGTAACAAGAG3′ 81
5′GCAAGTCTCCTCATTGAATCCAG3′
17 VEGF 5′AGGAGGAGGGCAGAATCATCA3′ 81
5′CTCGATTGGATGGCAGTAGCT3′
18 IL-10 5′GTGATGCCCCAAGCTGAGA3′ 86
5′CACGGCCTTGCTCTTGTTTT3′
19 TGF-β 5′CCTGGACACCAACTATTGCTTCA3′ 83
5′TGCGGAAGTCAATGTACAGCTG3′
20 IDO1 5′CTCTGCCAAATCCACAGGAAA3′ 79
5′TCTCAACTCTTTCTCGAAGCTGG3′
21 SOCS1 5′CCCTGGTTGTTGTAGCAGCTTAA3′ 80
5′GGTTTGTGCAAAGATACTGGGTATATG3′
22 TNF-α 5′CCCAGGGACCTCTCTCTAATCA3′ 84
5′ATGGGCTACAGGCTTGTCACTC3′
23 ACTB 5′CAGCAGATGTGGATCAGCAAG3′ 83
5′GCATTTGCGGTGGACGAT3′
24 TFRC 5′ACCGGCACCATCAAGCT3′ 80
5′TGATCACGCCAGACTTTGC3′
  1. Melting point of amplicon is calculated by melt curve analysis using SDS software v2.6 Applied Biosystems