Skip to main content

Table 1 Primer sequences for gene expression analysis

From: Increased ETV4 expression correlates with estrogen-enhanced proliferation and invasiveness of cholangiocarcinoma cells

Gene Accession no.   Primer sequence (5′ → 3′) Size (bp)
36B4 NM_001002.3 F
R
CTTCCCACTTGCTGAAAAG
CCAAATCCCATATCCTCGT
168
ETV4 NM_001986.2 F
R
GTCACTTCCAGGAGACGTGG
ATAGGCACTGGAGTAAAGGCAC
218