Skip to main content

Table 1 The list of primers used for Real time PCR studies

From: Epithelial to mesenchymal transition induces stem cell like phenotype in renal cell carcinoma cells

S. no Gene name Sequence
1 β-Actin F 5′CAAGAGATGGCCACGGCTGCT3′
R 5′TCCTTCTGCATCCTGTCGGCA3′
2 Vimentin F 5′TCTACGAGGAGGAGATGCGG3′
R 5′GGTCAAGACGTGCCAGAGAC3′
3 Snail F 5′GAAAGGCCTTCAACTGCAAA3′
R 5′TGACATCTGAGTGGGTCTGG3′
4 Slug F5′ATTCGGACCCACACATTACCTTG3′
R5′TGGAGAAGGTTTTGGAGCAGTTT3′
5 Twist F5′TGAGCAAGATTCAGACCCTCA3′
R 5′ATCCTCCAGACCGAGAAGG3′
6 ABCG2 F5′-CTGAGATCCTGAGCCTTTGG-3′
R5′-TGCCCATCACAACATCATCT-3′
7 MDR2 F5′-GCCTGGCAGCTGGAAGACAAATAC-3′
R5′-ATGGCCAAAATCACAAGGGTTAGC-3′
\