Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

TableĀ 1 The primers sequence for q-PCR amplification

From: SOX2OT knockdown derived changes in mitotic regulatory gene network of cancer cells

Gene symbol Primer sequence
SOX2OT
Gene ID: 347689
F: GGCTGGGAAGGACAGTTCG
R: AGATGATCTTGCCAGGCGATC
CDK2
Gene ID: 1017
F: CCCTTTCTTCCAGGATGTGA
R: TCACCCCTGTATTCCCAGAG
CDK2AP2
Gene ID: 10263
F: TGCCAGGCACTCTCTGACTA
R: AGATCCGGCCTACCTATGCT
GNL3L
Gene ID: 54552
F: TATCTTCTTGTGGCCCTTGG
R: AGAGAGCAAGCAGATTTGAACC
ACTR3
Gene ID: 10096
F: TTGAGTGGTGGTAGATTGAAGC
R: CCAAACTGCATATCGCTGCAT
SMC4
Gene ID: 10051
F: TGCAGAGGAATCCTTACCAG
R: TGTTCAGCAATGTGACCATC
INCENP
Gene ID: 3619
F: TCAGAACCAACTTTCTGGGG
R: CAAGAAGACTGCCGAAGAGC
GAPDH
Gene ID: 2597
F: GAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATG