Skip to main content

Advertisement

TableĀ 1 The primers sequence for q-PCR amplification

From: SOX2OT knockdown derived changes in mitotic regulatory gene network of cancer cells

Gene symbol Primer sequence
SOX2OT Gene ID: 347689 F: GGCTGGGAAGGACAGTTCG R: AGATGATCTTGCCAGGCGATC
CDK2 Gene ID: 1017 F: CCCTTTCTTCCAGGATGTGA R: TCACCCCTGTATTCCCAGAG
CDK2AP2 Gene ID: 10263 F: TGCCAGGCACTCTCTGACTA R: AGATCCGGCCTACCTATGCT
GNL3L Gene ID: 54552 F: TATCTTCTTGTGGCCCTTGG R: AGAGAGCAAGCAGATTTGAACC
ACTR3 Gene ID: 10096 F: TTGAGTGGTGGTAGATTGAAGC R: CCAAACTGCATATCGCTGCAT
SMC4 Gene ID: 10051 F: TGCAGAGGAATCCTTACCAG R: TGTTCAGCAATGTGACCATC
INCENP Gene ID: 3619 F: TCAGAACCAACTTTCTGGGG R: CAAGAAGACTGCCGAAGAGC
GAPDH Gene ID: 2597 F: GAGCGAGATCCCTCCAAAAT R: GGCTGTTGTCATACTTCTCATG