Skip to main content

Table 1 List of primers of ABC transporters used for real-time RT-PCR

From: Sulbactam-enhanced cytotoxicity of doxorubicin in breast cancer cells

Gene RefSeq Forward oligo sequence Reverse oligo sequence
ABCB1 NM_000927 AGCTCGTGCCCTTGTTAGACA GTCCAGGGCTTCTTGGACAA
ABCB5 NM_178559 CACAAAAGGCCATTCAGGCT GCTGAGGAATCCACCCAATCT
ABCB8 NM_007188 CATCGCCTTCAACTGCATGG GACCTTTGCACTGTCTGGGA
ABCB10 NM_012089 TGCGGTTGGATTTCTCACGA CACACAGAAACACGGCACTG
ABCC1 NM_004996 CGCTCTGGGACTGGAATGT AGGTAAAAACAAGGCACCCA
ABCC2 NM_000392 TGCACAAGCAACTGCTGAAC CCTCTGGCCTATGCTCAGGTT
ABCC3 NM_020038 ACCCAGTTTGATACCTGCACTGT GGACCCTGGTGTAGTCCATGA
ABCC4 NM_005845 TTGGACACGGTAACTGTTGCA GGAATGTCGGTTAGAGGTTTGG
ABCC5 NM_005688 ATTTGGACCCCTTCAACCAGTAC GGTAGCTGAGCAATACATTCTTTCAT
ABCC10 NM_033450 CCTGTTGTTGGTGCTCTTCC GGCCCTGTCCTTATGTAGGC
ABCG2 NM_004827 TATAGCTCAGATCATTGTCACAGTC GTTGGTCGTCAGGAAGAAGAG
GAPDH NM_002046 CCACCCATGGCAAATTCC TCGCTCCTGGAAGATGGTG