Skip to main content

Table 1 The primer sequences for RT-qPCR

From: HOXC6 gene silencing inhibits epithelial-mesenchymal transition and cell viability through the TGF-β/smad signaling pathway in cervical carcinoma cells

Name Sequence (5′–3′)
HOXC6 Forward: CTCCACGGTGACTGGAAGTG
Reverse: AGCTGCGGTAGTCATCATGC
TGF-β1 Forward: GATACGGAGTAACGTCGGGG
Reverse: CATTCCCTTGGAGCCAGGTC
TGF-βR II Forward: AGCAACTGCAGCATCACCTC
Reverse: TGATGTCTGAGAAGATGTCC
smad4 Forward: TGCTGGCATCGGTGTAGATGA
Reverse: TAGGGCATCCATGGTGAGAGA
smad7 Forward: TTCCTCCGCTGAAACAGGG
Reverse: CCTCCCAGTATGCCACCAC
E-cadherin Forward: GTGTTCGCTATTGGACGGGA
Reverse: TCATAACAGCCGTACCTGGC
N-cadherin Forward: CTGTCTGGAAAACACCGAGC
Reverse: TTTCTGCTCCCGCCACAAA
Vimentin Forward: GCGCGATGTTCGTCAACAAT
Reverse: TACTCACGAAGATGGCGAGC
GAPDH Forward: CACCAGGTTGTGTCCACTGA
Reverse: CCAGATGGGAGAATGGTCGC
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, GAPDH glyceraldehyde-3-phosphate dehydrogenase, HOXC6 homeobox C6, TGF-β, transforming growth factor-β/smad signaling pathway