Skip to main content

Advertisement

Table 1 The primer sequences for PCR used in the study

From: Knockdown of AGGF1 inhibits the invasion and migration of gastric cancer via epithelial–mesenchymal transition through Wnt/β-catenin pathway

Genes Forward (from 5′ to 3′) Reverse (from 5′ to 3′)
AGGF1 GCATCACACAGAACGGCTGTA TCATTTCTCCCACGTTGGAGTAT
E-Cadherin CGAGAGCTACACGTTCACGG GGGTGTCGAGGGAAAAATAGG
β-Catenin ACGGAGGAAGGTCTGAGGAG AGCCGCTTTTCTGTCTGGTT
Snail TCCAGAGTTTACCTTCCAGCA CTTTCCCACTGTCCTCATCTG
Vimentin GGACCAGCTAACCAACGACA AAGGTCAAGACGTGCCAGAG
GAPDH CGTCCCGTAGACAAAATGGT TTGATGGCAACAATCTCCAC