Skip to main content

Table 1 Primer sequence for RT-qPCR

From: Long non-coding RNA LINC01314 represses cell migration, invasion, and angiogenesis in gastric cancer via the Wnt/β-catenin signaling pathway by down-regulating KLK4

Gene Primer sequence (5′–3′)
LINC01314 F: TGGGGCTGCCCTGGCCCGAGGGAC
R: CCAGTGCAGGGTCCGAGGT
KLK4 F: ATCTGCCTACCTCCGGAGTC
R: TTAACTGTCCTGGATGGTTTT
Wnt-1 F: GCTAGCGAAAGTCATTGGC
R: CATTGCATCGAAGTCAGTG
β-catenin F: GCTAGCTAAGTCAGTCGGG
R: CGTATATAGCTAGCTGGCTA
cyclin D1 F: AAGCCTCAGCCCTCCCCAGCTGCCAG
R: AACCAACAACAAGGAGGATG
N-cadherin F: TTTGATGGAGGTCTCCTAACACC
R: ACGTTTAACACGTTGGAAATGTG
E-cadherin F: CGAGAGCTACACGTTCACGG
R: GGGTGTCGAGGGAAAAATAGG
GAPDH F: CGGAGTCAACGGATTTGGTAT
R: AGCCTTCTCCATGGTGGTGAAGAC
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, F forward, R reverse, N-cadherin neural cadherin, E-cadherin epithelial cadherin, GAPDH glyceraldehyde-3-phosphate dehydrogenase, KLK4 kallikrein 4