Skip to main content

Table 1 Primer sequences of miR-137, U6, GREM1, TGF-β1, Smad2, Smad3 and Smad4 used in RT-qPCR

From: Overexpression of mircoRNA-137 inhibits cervical cancer cell invasion, migration and epithelial–mesenchymal transition by suppressing the TGF-β/smad pathway via binding to GREM1

Gene Primer sequences (5′–3′)
miR-137 F: TTATTGCTTAAGAATACGCGTAG
R: TGGTGTCGTGGAGTCG
U6 F: GCTTCGGCACATATACTAAAAT
R: CGCTTCACGAATTTGCGTGTCAT
GREM1 F: TAACACTGCCACAAGAATGCAA
R: GCAAGACTGTGGTACAAGCTCCTAA
TGF-β1 F: GCTCCACGGAGAAGAACAGGCTG
R: CTGCTCCACCTTGGGCTTGC
Smad2 F: CGAAATGCCAGCGTAFAAAT
R: CTGCCTTCGGTATTCTGCTC
Smad3 F: GCCCGTTACCTACTCGGAGC
R: TGTTGACATTGGAGAGCAGC
Smad4 F: ATGCCTGTCTAGGCATTGTG
R: CTGAAGCCTCCCATCCAAT
GAPDH F: TGTGGGCATCAATGGATTTGG
R: ACACCATGTATTCCGGGTCAAT
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, miR-137 microRNA-137, GREM1 gremlin-1, F forward, R reverse, TGF-β1 transforming growth factor β1, GAPDH glyceraldehyde-3-phosphate dehydrogenase