Skip to main content

Table 2 Differentially expressed microRNAs identified by next generation sequencing

From: MiR-369-3p participates in endometrioid adenocarcinoma via the regulation of autophagy

miRNA information Statistics and regulation
Mature-miRNA Pre-miRNA Mature-sequence Fold change p-value FDR Regulation
hsa-miR-136-3p hsa-mir-136 CAUCAUCGUCUCAAAUGAGUCU 63.72 0.005402 0.035995 Down
hsa-miR-369-3p hsa-mir-369 AAUAAUACAUGGUUGAUCUUU 150.75 0.009838 0.053134 Down
hsa-miR-451a hsa-mir-451a AAACCGUUACCAUUACUGAGUU 69.29 0.048753 0.143407 Down
hsa-miR-493-5p hsa-mir-493 UUGUACAUGGUAGGCUUUCAUU 90.00 0.019385 0.081725 Down
hsa-miR-543 hsa-mir-543 AAACAUUCGCGGUGCACUUCUU 90.40 0.035484 0.117148 Down
hsa-miR-10b-5p hsa-mir-10b UACCCUGUAGAACCGAAUUUGUG 3.52 0.012481 0.061076 Up
hsa-miR-143-3p hsa-mir-143 UGAGAUGAAGCACUGUAGCUC 9.21 4.05E−08 0.000012 Up
hsa-miR-145-5p hsa-mir-145 GUCCAGUUUUCCCAGGAAUCCCU 2.89 0.012701 0.061076 Up