Table 2 Differentially expressed microRNAs identified by next generation sequencing
From: MiR-369-3p participates in endometrioid adenocarcinoma via the regulation of autophagy
miRNA information | Statistics and regulation | |||||
|---|---|---|---|---|---|---|
Mature-miRNA | Pre-miRNA | Mature-sequence | Fold change | p-value | FDR | Regulation |
hsa-miR-136-3p | hsa-mir-136 | CAUCAUCGUCUCAAAUGAGUCU | 63.72 | 0.005402 | 0.035995 | Down |
hsa-miR-369-3p | hsa-mir-369 | AAUAAUACAUGGUUGAUCUUU | 150.75 | 0.009838 | 0.053134 | Down |
hsa-miR-451a | hsa-mir-451a | AAACCGUUACCAUUACUGAGUU | 69.29 | 0.048753 | 0.143407 | Down |
hsa-miR-493-5p | hsa-mir-493 | UUGUACAUGGUAGGCUUUCAUU | 90.00 | 0.019385 | 0.081725 | Down |
hsa-miR-543 | hsa-mir-543 | AAACAUUCGCGGUGCACUUCUU | 90.40 | 0.035484 | 0.117148 | Down |
hsa-miR-10b-5p | hsa-mir-10b | UACCCUGUAGAACCGAAUUUGUG | 3.52 | 0.012481 | 0.061076 | Up |
hsa-miR-143-3p | hsa-mir-143 | UGAGAUGAAGCACUGUAGCUC | 9.21 | 4.05E−08 | 0.000012 | Up |
hsa-miR-145-5p | hsa-mir-145 | GUCCAGUUUUCCCAGGAAUCCCU | 2.89 | 0.012701 | 0.061076 | Up |