Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Inactivation of the Wnt/β-catenin signaling pathway underlies inhibitory role of microRNA-129-5p in epithelial–mesenchymal transition and angiogenesis of prostate cancer by targeting ZIC2

Gene Sequence (5′–3′)
miR-129-5p F: CAAAAAGCGGACAGG
R: CAGTGCGTGTCGTGGAGT
ZIC2 F: GAGGGCACCTTGTGATCATGT
R: ACAGGGTGGGAAAGAACGTG
Wnt F: CAGAAGGACCTTGTTTGCCAGG
R: CCTCAGGGTATTGCTGGACAAC
β-Catenin F: CAAGACCTCGTGCTCCAGTTAG
R: GACCAAAAGGTGATGCTGGACAG
E-Cadherin F: TGCCCAGAAAATGAAAAAGG
R: GTGTATGTGGCAATGCGTTC
Vimentin F: GAGAACTTTGCCGTTGAAGC
R: GCTTCCTGTAGGTGGCAATC
U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
GAPDH F: ACCCAGAAGACTGTGGATGG
R: TCTAGACGGCAGGTCAGGTC
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, miR-129-5p micro RNA-129-5p, ZIC2 zinc-finger protein of the cerebellum 2, GAPDH glyceraldehyde-3-phosphate dehydrogenase, F forward, R reverse