Skip to main content

Advertisement

Table 1 Primers for PCR-based assays and siRNAs used for transfection

From: Enhanced osteopontin splicing regulated by RUNX2 is HDAC-dependent and induces invasive phenotypes in NSCLC cells

TargetOligonucleotide sequence
qPCR
 OPNtF: GCCGAGGTGATAGTGTGGTT
R: AACGGGGATGGCCTTGTATG
 OPNaF: GCCGAGGTGATAGTGTGGTT
R: AACGGGGATGGCCTTGTATG
 OPNbF: ATCTCCTAGCCCCACAGAC
R: AAAATCAGTGACCAGTTCATCAG
 OPNcF: TGAGGAAAAGCAGAATGCTG
R: GTCAATGGAGTCCTGGCTGT
 β-actinF: CATTAAGGAGAAGCTGTGCT
R: ACTGAACCTGACCGTACAGCTCGTAGCTCTTCTCCAG
 GAPDHF: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
PCR
 OPNF: AGCAGAATCTCCTAGCCCCA
R: ACGGCTGTCCCAATCAGAAG
 E-cadherinF: TGCCCAGAAAATGAAAAAGG
R: GTGTATGTGGCAATGCGTTC
 N-cadherinF: GACAATGCCCCTCAAGTGTT
R: CCATTAAGCCGAGTGATGGT
 VimentinF: CTGCAGGACTCGGTGGACTT
R: GAAGCGGTCATTCAGCTCCT
 SnailF: TACAGCGAGCTGCAGGACTCTAAT
R: AGGACAGAGTCCCAGATGAGCATT
 SlugF: TGATGAAGAGGAAAGACTACAG
R: GCTCACATATTCCTTGTCACAG
 TwistF: GCCGACGACAGCCTGAGCAA
R: CGCCACAGCCCGCAGACTTC
 RUNX2F: ACGGCAGCGGACAGCAGA
R: TGCGGATAGCAACACAGTTCT
 GAPDHF: GGCTGCTTTTAACTCTGGTA
R: GACTGTGGTCATGAGTCCTT
siRNA
 scrambleUUCUCCGAACGUGUCACGUTT
 SRSF1CCAACAAGATAGAGTATAATT
TGAAGCAGGTGATGTATGTTT
 RUNX2CUCUGCACCAAGUCCUUUUTT
GGUUCAACGAUCUGAGAUUTT