Skip to main content

Advertisement

Table 1 Primer sequences for amplification of SWAP-70 or CD44s using in this study

From: SWAP-70 promotes glioblastoma cellular migration and invasion by regulating the expression of CD44s

PrimerSequences (5′–3′)
sh-SWAP-70 #1 senseTGCTGGAAGACATGTACCTATTCAAGAGATAGG
TACATGTCTTCCAGCTTTTTC
sh-SWAP-70 #1 antisenseTCGAGAAAAAAGCTGGAAGACATGTACCTATCT
CTTTGAATAGGTACAGTTCCAGCA
sh-SWAP-70 #2 senseTGCCCATCATGAAGGATTAATTCAAGAGATTAA
TCCTTCATGATGGGTTTTTTC
sh-SWAP-70 #2 antisenseTCGAGAAAAAAGCCCATCATGAAGGATTAATCT
CTTGAATTAATCCTTCATGATGGGCA
sh-CD44s senseATCGTATGACACATATTGCTTCTTCAAGAGAGA
AGCAATATGTGTCATACTTTTTTG
sh-CD44s antisenseTTCAAAAAAGTATGACACATATTGCTTCTCTCTT
GAAGAAGCAATATGTGTGTCATAC
pWPXLd-SWAP-70 senseCGGGATCCATGGGGAGCTTGAAGGAGGA
pWPXLd-SWAP-70 antisenseCGACGCGTCCCTCCGTCCTCTTTTTCTCTTT
pLV-EGFP-CD44s senseCGGAATTCATGGACAAGTTTTGGTGGC
pLV-EGFP-CD44s antisenseTAAGAATGCGGCCGCGCTACTTGTCATCGTCAT
CCTTGTAGTCGATCACCCCAATCTTCATGTCCACs