Skip to main content

Table 1 Primers used in qRT-PCR or constructs

From: The m6A eraser FTO facilitates proliferation and migration of human cervical cancer cells

PrimerSequence(5′–3′)
FTO-forwardCCCTGTGAGCAGCAACATAAG
FTO-reverseCAACCCGACCCAGTCTAAATC
E2F-forwardGCTCTGTTCCCTCCTGCTTT
E2F-reverseCAAATCAAATCGGGCACG
E2F-CDS FATGGCCTTGGCCGGGGCCCC
E2F-CDS RTCAGAAATCCAGGGGGGTGAGG
Myc-forwardGCCTTGGTTCATCTGGGTCTA
Myc-reverseTGCTTAGGAGTGCTTGGGAC
Myc-CDS FCTGGATTTTTTTCGGGTAGT
Myc-CDS RTTACGCACAAGAGTTCCGTAGC