Skip to main content

Table 1 Primers used in qRT-PCR or constructs

From: The m6A eraser FTO facilitates proliferation and migration of human cervical cancer cells

Primer Sequence(5′–3′)
FTO-forward CCCTGTGAGCAGCAACATAAG
FTO-reverse CAACCCGACCCAGTCTAAATC
E2F-forward GCTCTGTTCCCTCCTGCTTT
E2F-reverse CAAATCAAATCGGGCACG
E2F-CDS F ATGGCCTTGGCCGGGGCCCC
E2F-CDS R TCAGAAATCCAGGGGGGTGAGG
Myc-forward GCCTTGGTTCATCTGGGTCTA
Myc-reverse TGCTTAGGAGTGCTTGGGAC
Myc-CDS F CTGGATTTTTTTCGGGTAGT
Myc-CDS R TTACGCACAAGAGTTCCGTAGC
\