Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Over-expression of CDX2 alleviates breast cancer by up-regulating microRNA let-7b and inhibiting COL11A1 expression

GenesForward primer sequences (5′-3′)Reverse primer sequences (5′-3′)
CDX2CCACGCTGGGGCTCTCTGTCTAGCAGAGTCCACGCTC
let-7bTGAGGTAGTAGGTTGTGTGGTTGCGAGCACAGAATTAATACGAC
GAPDHACCTGACCTGCCGTCTAGAATCCACCACCCTGTTGCTGTA
COL11A1TGGTGATCAGAATCAGAAGTTCGAGGAGAGTTGAGAATTGGGAATC
  1. CDX2, caudal type homeobox 2; let-7b, microRNA let-7b; COL11A1, collagen type XI alpha 1 chain; GAPDH, glyceraldehyde-3-phosphate dehydrogenase