Skip to main content

Table 1 Primer sequence for real time RT-PCR

From: Silencing of AURKA augments the antitumor efficacy of the AURKA inhibitor MLN8237 on neuroblastoma cells

Primer namePrimer sequence (5′–3′)
P21 forwardCTTCGACTTTGTCACCGAGA
P21 reverseGGTCCACATGGTCTTCCTCT
Bmi1 forwardCGTGTATTGTTCGTTACCTGGA
Bmi1 reverseTTCAGTAGTGGTCTGGTCTTGT
CIAP2 forwardAAGCTACCTCTCAGCCTACTTT
CIAP2 reverseCCACTGTTTTCTGTACCCGGA
NEFL forwardCGACAGCTTGATGGACGAAAT
NEFL reverseGATCTGCGCGTACTGGATCTG