Skip to main content

Table 1 Primer sequences for RT-qPCR

From: LINC00908 negatively regulates microRNA-483-5p to increase TSPYL5 expression and inhibit the development of prostate cancer

GeneSequences (5′-3′)
LINC00908F: CTATCCACGGACGCCTTCTC
R: CTTGGTGTGTCCTCCCTTCC
miR-483-5pF: AAGACGGGAGGAAAGAAGGGAG
R: GTGCAGGGTCCGAGGTATTC
TSPYL5F: CGTGGGAAGGCCGAAAAATG
R: TCCCACCAGCTATGACCTGA
β-actinF: CGGGATCCATGGATGATGATATCGCCGCGC
R: CGGAATTCCTAGAAGCATTTGCGGTGGACG
U6F: CGCTTCGGCAGCACATATACTA
R: CGCTTCACGAATTTGCGTGTCA
  1. F forward, R reverse