Skip to main content

Table 1 Related PCR primers and primers for plasmids

From: CREB1-induced miR-1204 promoted malignant phenotype of glioblastoma through targeting NR3C2

Gene namePCR primers (5′-3′)
miR-1204F:GUGGCCUGGUCUCCAUUACC
R:CTCTACAGCTATATTGCCAGCCAC
CREB1F:TGCAACATCATCTGCTCCCA
R:CTGAATAACTGATGGCTGGGC
NR3C2F:GAGAGCCCACATTGCTAGCA
R:GCCCTGCTGGAATCAACTCT
GAPDHF:GAGAAGGCTGGGGCTCATTT
R:AGTGATGGCATGGACTGTGG
U6F:CTCGCTTCGGCAGCACA R:AACGCTTCACGAATTTGCGT
Plasmid nameRelated sequences (5′-3′)
NC mimicUCCCGGGGUGGUCUCCAUUAU
miR-1204 mimicUCGUGGCCUGGUCUCCAUUAU
NC inhibitorAUAAUGGAGACCACCCCGGGA
miR-1204 inhibitorAUAAUGGAGACCAGGCCACGA
sh-NCCCGCCAGAAATGCAAATTCTTATTCCTCGAGGAATAAGAATTTGCATTTCTGTTTTTG
sh-CREB1#1CCGCCAACTATTGCAGAAAGTGAAGCTCGAGCTTCACTTTCTGCAATAGTTGTTTTTG
sh-CREB1#2CCGCGAAAATTTTGAATGACTTATCCTCGAGGATAAGTCATTCAAAATTTTCTTTTTG
sh¬NCCCGCCAGAAACAACAAAAAGTAAAACTCGAGTTTTACTTTTTGTTGTTTCTGTTTTTG
sh¬NR3C2#1CCGCGAATAATAGTCTTTATCATCCCTCGAGGGATGATAAAGACTATTATTCTTTTTG
sh¬NR3C2#2CCGCGAAACACAGCTTACGTTGACACTCGAGTGTCAACGTAAGCTGTGTTTCTTTTTG
pcDNA3.1/CREB1ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCTGAAAACCAAC
AAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCTATGCCAGCAGCTCATGCAAC
ATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAATGGGCAGACAGTTCAAGTCCATGGAGTCATT
CAGGCGGCCCAGCCATCAGTTATTCAGTCTCCACAAGTCCAAACAGTTCAGATTTCAACTATTGCAGAAA
GTGAAGATTCACAGGAGTCAGTGGATAGTGTAACTGATTCCCAAAAGCGAAGGGAAATTCTTTCAAGGAG
GCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAG
AAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTA
GCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGT
ACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTAT
GCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAG
ACGTACAAACATACCAGATTCGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTC
CCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCACGAAAGAGAGAGGTCCGTCTAATGAAGAACAGG
GAAGCAGCTCGAGAGTGTCGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAGAGTGGCAGTGC
TTGAAAATCAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGACCTTTACTGCCACAAATCAGA
T