Skip to main content

Table 1 The sequences of gene overexpression and interference were presented

From: Long noncoding RNA BSN-AS2 induced by E2F1 promotes spinal osteosarcoma progression by targeting miR-654-3p/SYTL2 axis

shRNASequences (5′-3′)
sh-NCCCGGACGTGTGCCGAGTCTCTATGGTCTCGAGTGCACACGGCTCAGAGATACCATTTTTG
sh-BSN-AS2#1CCGGCTTCGGTCGACCCTCCGGTGGACTCGAGGAAGCCAGCTGGGAGGCCACCTTTTTTG
sh-BSN-AS2#2CCGGATGAAGGGGCGAGGGAGTGTAACTCGAGTACTTCCCCGCTCCCTCACATTTTTTTG
sh-BSN-AS2#3CCGGACGACTATCGGTCGGACGACTCTCGAGTGCTGATAGCCAGCCTGCTGATTTTTTTG
sh-NCCCGGATATTGATCAGTCATTAGATGTCTCGAGTATAACTAGTCAGTAATCTACATTTTTG
sh-E2F1CCGGGAGACACGAGACGCGGAGTCGACTCGAGCTCTGTGCTCTGCGCCTCAGCTTTTTTG
sh-NCCCGGACAGAAGATGTCGGTTGGATGTCTCGAGTGTCTTCTACAGCCAACCTACATTTTTG
sh-SYTL2CCGGTCGATATTTGATGTGCTCACCCCTCGAGAGCTATAAACTACACGAGTGGGTTTTTG
mimicsSequences (5′-3′)
NC mimicsGCUGCUGAAUCAUUAUCCCCUU
miR-654-3p mimicsUGGUUUACCGUCCCACAUACAU
InhibitorSequences (5′-3′)
NC inhibitorAAGUCAGGUGAUGGACAGCAUA
miR-654-3p inhibitorAAGGUGAUGGUCAGCAGACAUA
pcDNA3.1Sequences (5′-3′)
pcDNA3.1/E2F1ATGGCCTTGGCCGGGGCCCCTGCGGGCGGCCCATGCGCGCCGGCGCTGGAGGCCCTGCTCGGGGCCGGCGCGCTGCGGCTGCTCGACTCCTCGCAGATCGTCATCATCTCCGCCGCGCAGGACGCCAGCGCCCCGCCGGCTCCCACCGGCCCCGCGGCGCCCGCCGCCGGCCCCTGCGACCCTGACCTGCTGCTCTTCGCCACACCGCAGGCGCCCCGGCCCACACCCAGTGCGCCGCGGCCCGCGCTCGGCCGCCCGCCGGTGAAGCGGAGGCTGGACCTGGAAACTGACCATCAGTACCTGGCCGAGAGCAGTGGGCCAGCTCGGGGCAGAGGCCGCCATCCAGGAAAAGGTGTGAAATCCCCGGGGGAGAAGTCACGCTATGAGACCTCACTGAATCTGACCACCAAGCGCTTCCTGGAGCTGCTGAGCCACTCGGCTGACGGTGTCGTCGACCTGAACTGGGCTGCCGAGGTGCTGAAGGTGCAGAAGCGGCGCATCTATGACATCACCAACGTCCTTGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCACAGTGGGCGTCGGCGGACGGCTTGAGGGGTTGACCCAGGACCTCCGACAGCTGCAGGAGAGCGAGCAGCAGCTCCAGCGCCTGGCCTACGTGACGTGTCAGGACCTTCGTAGCATTGCAGACCCTGCAGAGCAGATGGTTATGGTGATCAAAGCCCCTCCTGAGACCCAGCTCCAAGCCGTGGACTCTTCGGAGAACTTTCAGATCTCCCTTAAGAGCAAACAAGGCCCGATCGATGTTTTCCTGTGCCCTGAGGAGACCGTAGGTGGGATCAGCCCTGGGAAGACCCCATCCCAGGAGGTCACTTCTGAGGAGGAGAACAGGGCCACTGACTCTGCCACCATAGTGTCACCACCACCATCATCTCCCCCCTCATCCCTCACCACAGATCCCAGCCAGTCTCTACTCAGCCTGGAGCAAGAACCGCTGTTGTCCCGGATGGGCAGCCTGCGGGCTCCCGTGGACGAGGACCGCCTGTCCCCGCTGGTGGCGGCCGACTCGCTCCTGGAGCATGTGCGGGAGGACTTCTCCGGCCTCCTCCCTGAGGAGTTCATCAGCCTTTCCCCACCCCACGAGGCCCTCGACTACCACTTCGGCCTCGAGGAGGGCGAGGGCATCAGAGACCTCTTCGACTGTGACTTTGGGGACCTCACCCCCCTGGATT TCTGA
pcDNA3.1/SYTL2ATGAGAAAGTCTGTTCCAGCATTTCTCCAAGATGAGAGTGATGACAGAGAAACAGATACAGCATCAGAAAGCAGTTACCAGCTCAGCAGACACAAGAAGAGCCCGAGCTCTTTAACCAATCTTAGCAGCTCCTCTGGCATGACGTCCTTGTCTTCTGTGAGTGGCAGTGTGATGAGTGTTTATAGTGGAGACTTTGGCAATCTGGAAGTTAAAGGAAATATTCAGTTTGCAATTGAATATGTGGAGTCACTGAAGGAGTTGCATGTTTTTGTGGCCCAGTGTAAGGACTTAGCAGCAGCGGATGTAAAAAAACAGCGTTCAGACCCATATGTAAAGGCCTATTTGCTACCAGACAAAGGCAAAATGGGCAAGAAGAAAACACTCGTAGTGAAGAAAACCTTGAATCCTGTGTATAACGAAATACTGCGGTATAAAATTGAAAAACAAATCTTAAAGACACAGAAATTGAACCTGTCCATTTGGCATCGGGATACATTTAAGCGCAATAGTTTCCTAGGGGAGGTGGAACTTGATTTGGAAACATGGGACTGGGATAACAAACAGAATAAACAATTGAGATGGTACCCTCTGAAGCGGAAGACAGCACCAGTTGCCCTTGAAGCAGAAAACAGAGGTGAAATGAAACTAGCTCTCCAGTATGTCCCAGAGCCAGTCCCTGGTAAAAAGCTTCCTACAACTGGAGAAGTGCACATCTGGGTGAAGGAATGCCTTGATCTACCACTGCTAAGGGGAAGTCATCTAAATTCTTTTGTTAAATGTACCATCCTTCCAGATACAAGTAGGAAAAGTCGCCAGAAGACAAGAGCTGTAGGGAAAACCACCAACCCTATCTTCAACCACACTATGGTGTATGATGGGTTCAGGCCTGAAGATCTGATGGAAGCCTGTGTAGAGCTTACTGTCTGGGACCATTACAAATTAACCAACCAATTTTTGGGAGGTCTTCGTATTGGCTTTGGAACAGGTAAAAGTTATGGGACTGAAGTGGACTGGATGGACTCTACTTCAGAGGAAGTTGCTCTCT GGGAGAAGATGGTAAACTCCCCCAATACTTGGATTGAAGCAACACTGCCTCTCAGAATGCTTTTGATTGC CAAGATTTCC AAATTGA