Skip to main content

Table 2 The sequences of gene primer were presented

From: Long noncoding RNA BSN-AS2 induced by E2F1 promotes spinal osteosarcoma progression by targeting miR-654-3p/SYTL2 axis

GenesPrimer sequences (5′-3′)
BSN-AS2F: GCAGGCGTCATAAGGACAGG
R: TGCGTCTCTGAATACACTTGTTC
miR-654-3pF: CCGAGTATGTCTGCTGACCAT
R: CTCAACTGGTGTCGTGGA
miR-515-5pF: GCCGATTCTCCAAAAGAAAGCAC
R: CTCAACTGGTGTCGTGGA
miR-219a-5pF: CCGAGTGATTGTCCAAACG
R: CTCAACTGGTGTCGTGGA
miR-4782-3pF: GCCGAGTGATTGTCTTCATATC
R: CTCAACTGGTGTCGTGGA
miR-6766-3pF: CCGAGGATTGTCTTCCCCCA
R: CTCAACTGGTGTCGTGGA
miR-2355-3pF: GCCGAGATTGTCCTTGCTGTT
R: CTCAACTGGTGTCGTGGA
E2F1F: ACGCTATGAGACCTCACTGAA
R: TCCTGGGTCAACCCCTCAAG
SYTL2F: GCCCAGTGTAAGGACTTAGCA
R: GCCTTTGTCTGGTAGCAAATAGG
CLN8F: TGGTCGCTGGCTTTGTCTTC
R: AGAACGGTAAGTGGCATTCAG
GAPDHF: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT