Skip to main content

Table 1 Primer sequences

From: Single-nucleotide polymorphism rs17548629 in RIPK1 gene may be associated with lung cancer in a young and middle-aged Han Chinese population

  Direction Primer sequence
RIPK1 3′-UTR-Wt + TCGAGCTGGTACCTTCACCCAGCCTGAGTGCCCTGGAGAGGGAACAGGAAATGCTGGC
GGCCGCCAGCATTTCCTGTTCCCTCTCCAGGGCACTCAGGCTGGGTGAAGGTACCAGC
RIPK1 3′-UTR-Mut + TCGAGCTGGTACCTTCACCCAGCCTGAGTGTCCTGGAGAGGGAACAGGAAATGCTGGC
GGCCGCCAGCATTTCCTGTTCCCTCTCCAGGACACTCAGGCTGGGTGAAGGTACCAGC
Has-miR-1197 inhibitor sponge + TCGAGAGAAGTAGACCATGTGTCCTACGATAGAAGTAGACCATGTGTCCTATCACAGAAGTAGACCATGTGTCCTAGC
GGCCGCTAGGACACATGGTCTACTTCTGTGATAGGACACATGGTCTACTTCTATCGTAGGACACATGGTCTACTTCTC