Skip to main content

Table 3 Primer sequence

From: A glycolysis-based 4-mRNA signature correlates with the prognosis and cell cycle process in patients with bladder cancer

GeneForward (5′–3′)Reverse (5′–3′)
PKMATGTCGAAGCCCCAAGTGAATGGGTGGTGAATCAATGTCCA
NUP205GTACTGGGATGGAAAGCGATGGCTCTGGACTGAGTTCTAGGG
PFKFB1GGCCAGTATCGACGAGAGGCAAAAACCGCAACATGACCTTC
NUPL2GCTTTGGATTGTCTGAGAACCCCAAGCCTCAATTCCTCTGGTG
β-actinCATGTACGTTGCTATCCAGGCCTCCTTAATGTCACGCACGAT