Skip to main content

Table 1 The primers used for qPCR assay

From: GSK-J4 induces cell cycle arrest and apoptosis via ER stress and the synergism between GSK-J4 and decitabine in acute myeloid leukemia KG-1a cells

Gene Forward/reverse Primer Sequence(5′–3′)
PKC-α F
R
GTCCACAAGAGGTGCCATGAA
AAGGTGGGGCTTCCGTAAGT
GAPDH F
R
CATCACGCCACAGTTTCC
ATCATCAGCAATGCCTCC
\